Table 3

Primer sequences and real-time PCR conditions used for microbiota analysis

Target groupPrimer sequence (5’−3’)Genomic DNA standardATReference
UniversalF: AAACTCAAAKGAATTGACGG
R: CTCACRRCACGAGCTGAC
Bacteroides vulgatus
ATCC 8482
62 18
Staphylococcus F: GAT GTG CGA AAG CGT GGG GAT
R: GAA CTG AGA ACA ACT TTA TGG GA
S. aureus
ATCC 12600
60 24
Bifidobacterium F: CGC GTC YGG TGT GAA AG
R: CCC CAC ATC CAG CAT CCA
B. longum subspecies infantis
ATCC 15697
60 18
Bacteroides fragilis F: TCRGGAAGAAAGCTTGCT
R: CATCCTTTACCGGAATCCT
B. fragilis
ATCC 25285
60 21
Escherichia coli F: GTTAATACCTTTGCTCATTGA
R: ACCAGGGTATCTAATCCTGTT
E. coli
ATCC 25922
60 23
Candida F: TTGGTGGAGTGAT TTGTCTGCT
R: TCTAAGGGCATCACAGACCT G
C. albicans
ATCC10231
60 22
  • AT, anneling temperature (°C).